View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3276_low_12 (Length: 333)
Name: NF3276_low_12
Description: NF3276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3276_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 20 - 327
Target Start/End: Complemental strand, 4441427 - 4441122
Alignment:
| Q |
20 |
tgcacgtctagatgaattccaccacaaatactgaggaacaaacaaataatgttatatcacatttcataactatttagcactgatacttaagattgaagtc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4441427 |
tgcacgtctagatgaattccaccacaaatactgaggaacaaacaaataatgttatatcacatttcataactatttaggactgatacttaagattgaagtc |
4441328 |
T |
|
| Q |
120 |
atatacactttggtgtcggacaacaacacagacactaacatatttggttacattcaattgcttacatatttgcaaagtattatcaaggttgacagggcgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4441327 |
atatacactttggtgtcggacaacaacac-gacactaacatatt-ggttacattcaattgcttacatatttgcaaagtattatcaaggttgacagggcgt |
4441230 |
T |
|
| Q |
220 |
gtgtaagtgtttcatagatttaggagattaattgctccttaaaaatattcagatatttgcgatggatatcaatgaagaagtatccactgaagtcctaacc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4441229 |
gtgtaagtgtttcatagatttaggagattaattgctccttaaaaatattcagatatttgcgatggatatcaatgaagaagtatccactgaagtcctaacc |
4441130 |
T |
|
| Q |
320 |
tttgctac |
327 |
Q |
| |
|
|||||||| |
|
|
| T |
4441129 |
tttgctac |
4441122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 113
Target Start/End: Original strand, 8383315 - 8383383
Alignment:
| Q |
44 |
caaatactgaggaacaaacaaataatgttatatcacatttcataactatttagcactgatacttaagatt |
113 |
Q |
| |
|
|||| |||| ||||||||| ||| || |||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
8383315 |
caaagactgtggaacaaacgaattattttatatcacatt-cataactatttagcactgatacataagatt |
8383383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University