View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3276_low_2 (Length: 517)
Name: NF3276_low_2
Description: NF3276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3276_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 157 - 499
Target Start/End: Original strand, 52477420 - 52477760
Alignment:
| Q |
157 |
ctgttgtcaactatttgtatggaagacaacttcattgtttagttttgaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcaga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477420 |
ctgttgtcaactatttgtatggaagacaacttcattgtttagtttttaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcaga |
52477519 |
T |
 |
| Q |
257 |
gaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtcaaaaa |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52477520 |
gaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtc--agtcaaaaa |
52477617 |
T |
 |
| Q |
357 |
taaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgcagtg |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477618 |
taaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgcagtg |
52477717 |
T |
 |
| Q |
457 |
tctctcctatgaagggtaatcctcgatttcccggaggaatgcc |
499 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477718 |
tctctcctatgaagggtaatcctcgatttcccggaggaatgcc |
52477760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 52477282 - 52477358
Alignment:
| Q |
19 |
gtcacgtcacatgctcactgcatagtgtctaagtgcaagtgttggtttatatgagtgacgtttagttggatagaata |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477282 |
gtcatgtcacatgctcactgcatagtgtctaagtgcaagtgttggtttatatgagtgacgtttagttggatagaata |
52477358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University