View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3276_low_27 (Length: 234)
Name: NF3276_low_27
Description: NF3276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3276_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 5950669 - 5950870
Alignment:
| Q |
20 |
aagggaaaaagaagacgtaccatggtgccagcgatatccatttgatatgtcatcagctctattgactgcacccgacaatgattcttgtgacgatgaaaca |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950669 |
aagggaaaaagaagacgtaccagggtgccagcgatatccatttgatatgtcatcaactctattgactgcacccgacaatgattcttgtgacgatgaaaca |
5950768 |
T |
|
| Q |
120 |
gaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtctggataactgttcgtcctatctggaagtagcattgatatctctg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950769 |
gaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtcttgataactgttcgtcctatctggaagtagcattgatatctctg |
5950868 |
T |
|
| Q |
220 |
ct |
221 |
Q |
| |
|
|| |
|
|
| T |
5950869 |
ct |
5950870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University