View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3276_low_28 (Length: 230)

Name: NF3276_low_28
Description: NF3276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3276_low_28
NF3276_low_28
[»] chr1 (1 HSPs)
chr1 (1-230)||(26278628-26278857)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 26278857 - 26278628
Alignment:
1 atgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaaattacctaattgaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26278857 atgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaaattacctaattgaac 26278758  T
101 tcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttctggtttattccagaatagcaacaatcgtttactgattctttcaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||| |||||||||||||||    
26278757 tcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttttggtttattccagaatagcaacagccgttaactgattctttcaaa 26278658  T
201 acacaacttcaatcaaaattctccctccat 230  Q
    |||| |||||||||||||||||||||||||    
26278657 acactacttcaatcaaaattctccctccat 26278628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University