View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_high_37 (Length: 237)
Name: NF3277_high_37
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 221
Target Start/End: Original strand, 37808921 - 37809120
Alignment:
| Q |
22 |
tgattgtggcttcattatccactcgctgtcaattgtcattgtgatatacttcattttaatgttgaattactacttcattcttcgatgttggctgaataaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808921 |
tgattgtggcttcattatccactcgctgtcaattgtcattgtgatatactacattttaatgttgaattactacttcattcttcgatgttggctgaataaa |
37809020 |
T |
|
| Q |
122 |
caaggaaaaactattatcctgaaatatattacttgtttgctttcaaagctggatacaaacctatatgtgatgatataattcaagttggatccataaaaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809021 |
caaggaaaaactattatcctgaaatatatttcttgtttgctttcaaagctggatacaaacctatatgtgatgatataattcaagttggatccataaaaac |
37809120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University