View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_low_14 (Length: 389)
Name: NF3277_low_14
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 385
Target Start/End: Original strand, 35915853 - 35916237
Alignment:
| Q |
1 |
gaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915853 |
gaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttg |
35915952 |
T |
 |
| Q |
101 |
catgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915953 |
catgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctg |
35916052 |
T |
 |
| Q |
201 |
ttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916053 |
ttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgc |
35916152 |
T |
 |
| Q |
301 |
tgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916153 |
tgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University