View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_low_31 (Length: 249)
Name: NF3277_low_31
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 11991879 - 11991790
Alignment:
| Q |
1 |
cacttgaaattttgaaacaaggttcagcattatctacctttccttttgttttagggtcaaattgattacacttctattttcttgtaaatt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11991879 |
cacttgaaattttgaagaaaggttcagcattatctacctcttcttttgttttagggtcaaattgattacacttctattttcttgtaaatt |
11991790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 237
Target Start/End: Complemental strand, 11991227 - 11991183
Alignment:
| Q |
193 |
catggtttcagctactaaggaggagacttcaatatcctcgcattc |
237 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11991227 |
catggtttcagctactaagggggagacttcgatatcctcgcattc |
11991183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 12021424 - 12021381
Alignment:
| Q |
193 |
catggtttcagctactaaggaggagacttcaatatcctcgcatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
12021424 |
catggtttcagctactaaggaggagactgcaatatcctcacatt |
12021381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University