View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_low_32 (Length: 249)
Name: NF3277_low_32
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 37808608 - 37808363
Alignment:
| Q |
1 |
tttttatgataaaaatagcatattagagaggttttgagttaatacaaactccaattcctgatagtttaatcaaactagtttttaaaattagccatccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808608 |
tttttatgataaaaatagcatattagagaggttttgagttgatacaaactccaattcctgatagtttaatcaaactagtttttaaaattagccatccacc |
37808509 |
T |
|
| Q |
101 |
tagaacttgtgactgcattttgcacatggattccctctattttagaaataagaaaatgcacaattgtaaaaagc----------nnnnnnnnnnnaacca |
190 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37808508 |
tggaacttgtgactgcattttgcacatggattccctctattttagaaataagaaaatgcacaattgtaaaaagctttttttttttttttttttttaacca |
37808409 |
T |
|
| Q |
191 |
aaaggcgttgtaaacaaagacttttgactctttattattactttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808408 |
aaaggcgttgtaaacaaagacttttgactctttattattactttct |
37808363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University