View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_low_38 (Length: 237)
Name: NF3277_low_38
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 172193 - 172415
Alignment:
| Q |
1 |
actctctgatattatggaagaggatgaacttgatagaagttgagactatggtctgattgtgactatggaactctctaataatgacttgcttttatttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
172193 |
actctctgatattatggaagaggatgaacttgatagaagttgagactatggtctgattgtgactatggaactctctaataatgacttgcttttatttgtt |
172292 |
T |
 |
| Q |
101 |
gtttgttgcagggttgtgctcccaaaaatggccacatgctcaactattctggaccacttctgcctcgagaggataaccttgaagagatccttaaggagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
172293 |
gtttgttgcagggttgtgctcccaaaaatggccacattctcaactattctggaccacttctgcctcgagaggataaccttgaagagatccttaaggagca |
172392 |
T |
 |
| Q |
201 |
tgaaagacaaatccaacaagctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
172393 |
tgaaagacaaatccaacaagctg |
172415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University