View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3277_low_42 (Length: 232)
Name: NF3277_low_42
Description: NF3277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3277_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 4477460 - 4477317
Alignment:
| Q |
77 |
atgacttaatgtgttacct-tctggatgcatgtctttcaactatcgacgaaattcagtgaatctcttatcagtctagccattcatcaccgtcagattgta |
175 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477460 |
atgacttaatgtgttaccgatttggatgcatgtctttcaactatcgacgaaattcagtgaatctcttatcagtctagccattcatcaccgtcagattgta |
4477361 |
T |
|
| Q |
176 |
cattcttaactttaccacccccaattattctttaagcgtatcctt |
220 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
4477360 |
caatcttaactttacca-ccccaattattctttaaacgtatcctt |
4477317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University