View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3279-Insertion-7 (Length: 291)
Name: NF3279-Insertion-7
Description: NF3279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3279-Insertion-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 290
Target Start/End: Original strand, 33122561 - 33122852
Alignment:
| Q |
8 |
ggatggtaatcagttgattatagtggattaagtcatcgacaatacttaaaataaaatgtctccgtaatgaaaacacgatatccaaagactaaattcaaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||| ||| ||| ||||||||||| |||| |
|
|
| T |
33122561 |
ggatggtaatcagttgattatagtggattaagtcatcgacaatacaaaaaataaaatgtctatgtaatggaaagacggtatgtaaagactaaatctaaaa |
33122660 |
T |
 |
| Q |
108 |
tgatattttaacataactaaaatcagaacgctttgatatttacatgaatctttgcatattcaagcatagattatatcagtcc----aaaga---aatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| || ||| |
|
|
| T |
33122661 |
tgatattttaacataactaaaatcagaacgc-ttgatatttacatgaatctttgcatattcaagcatagataatatcagtccttcaaaagaaagaaattt |
33122759 |
T |
 |
| Q |
201 |
ttaacaactctataaagaccacctgccacgatccctcgaaaa---gaatatggcagcccaagtatgaggttaatcatagagttattacgcttc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33122760 |
ttaacaactctataaagaccacctgccacgatccctgaaaaatagggatatggcagcccaagtctgaggttaatcatagagttattatgcttc |
33122852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University