View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3279-Insertion-7 (Length: 291)

Name: NF3279-Insertion-7
Description: NF3279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3279-Insertion-7
NF3279-Insertion-7
[»] chr1 (1 HSPs)
chr1 (8-290)||(33122561-33122852)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 290
Target Start/End: Original strand, 33122561 - 33122852
Alignment:
Q  8 ggatggtaatcagttgattatagtggattaagtcatcgacaatacttaaaataaaatgtctccgtaatgaaaacacgatatccaaagactaaattcaaaa 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||  |||||| ||| ||| |||  |||||||||||  ||||    
T  33122561 ggatggtaatcagttgattatagtggattaagtcatcgacaatacaaaaaataaaatgtctatgtaatggaaagacggtatgtaaagactaaatctaaaa 33122660  T
Q  108 tgatattttaacataactaaaatcagaacgctttgatatttacatgaatctttgcatattcaagcatagattatatcagtcc----aaaga---aatttt 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||    |||||   || |||    
T  33122661 tgatattttaacataactaaaatcagaacgc-ttgatatttacatgaatctttgcatattcaagcatagataatatcagtccttcaaaagaaagaaattt 33122759  T
Q  201 ttaacaactctataaagaccacctgccacgatccctcgaaaa---gaatatggcagcccaagtatgaggttaatcatagagttattacgcttc 290  Q
    ||||||||||||||||||||||||||||||||||||  ||||   | |||||||||||||||| ||||||||||||||||||||||| |||||    
T  33122760 ttaacaactctataaagaccacctgccacgatccctgaaaaatagggatatggcagcccaagtctgaggttaatcatagagttattatgcttc 33122852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University