View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3279R-Insertion-2 (Length: 220)
Name: NF3279R-Insertion-2
Description: NF3279R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3279R-Insertion-2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 30506979 - 30507190
Alignment:
| Q |
9 |
ttgagatggcgacaggaaaaagtatgaaaggtaaaaattggggtaaagaacatgattctgttttcttcacactataggttgaaactttgaatgacagttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30506979 |
ttgagatggcgacaggaaaaagtatgaaaggtaaaaattggggtaaagaacatgattctgttttcttcacactataggttgaaactttgaatgacagttc |
30507078 |
T |
 |
| Q |
109 |
ctttctcattgactggtatgcctctattaatttccccctttctttttactaccattgtatttcccttccctagagagaaaaataaaactttaatttctta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30507079 |
ctttctcattgactggtatgcctctattaatttccccctttctttttactaccattttatttcccttccctagagagagaaataaaactttaatttctta |
30507178 |
T |
 |
| Q |
209 |
tactgttttgtc |
220 |
Q |
| |
|
| |||||||||| |
|
|
| T |
30507179 |
tgctgttttgtc |
30507190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University