View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3279_low_5 (Length: 252)
Name: NF3279_low_5
Description: NF3279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3279_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 38482736 - 38482495
Alignment:
| Q |
11 |
cacagagagtaaatacaaacaataggatcatgtttaatgcagtcaaaaattgatacaatcatgtaatcaatgagtttaggccgtcaaatgaagatcacac |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38482736 |
cacagagagtaaacacaaacaataggatcatgtttgatgcagtcaaaaattgatacaatcatgtaatcaatgagtttaggccgccaaatgaagatcacac |
38482637 |
T |
 |
| Q |
111 |
gatctagattttaatttcagaattttagatctaaactgtctgatcttgattggacggatccgaggtgttaactgcaactaactgcatccaatgccgacta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38482636 |
gatctagattttaatttcagaattttagatctaaactgtctgatcttgattggatggatccgaggtgttaactgcaactaactgcatccaatgccgacga |
38482537 |
T |
 |
| Q |
211 |
agcctaatctaattcccaaacaatgatggatggaaccaacac |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38482536 |
agcctaatctaattcccaaacaatgatagatggaaccaacac |
38482495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University