View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3280_low_3 (Length: 377)
Name: NF3280_low_3
Description: NF3280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3280_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 9617672 - 9617526
Alignment:
| Q |
1 |
gggtcttaagtaaaggaagatgaacagagcaatgagtcatagtggctacacgtaaactccacaaatggagaatcacaagtgtttcgcaggaggagaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9617672 |
gggtcttaagtaaaggaagatgaacagaacaatgagtcatagtggctacacgtaaactcca-aaatggagaatcacaagtgtttcgcaggaggagaaaat |
9617574 |
T |
|
| Q |
101 |
ggtaggcggcaaaggggggaagcctaatactaacgttagacggagatc |
148 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
9617573 |
ggtaggcggcaaaggggagaagcctaatactaacgctagacggagatc |
9617526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 266 - 361
Target Start/End: Complemental strand, 9617532 - 9617439
Alignment:
| Q |
266 |
ggagatcatgactgcgttgattaatcggtagaagtcgtctgcgttctccacatcggcatcttggaagtcgagaactgagagtgagtggcataatgg |
361 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || |||||| |||||| | ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
9617532 |
ggagatcatgactgcgttgattaatcgatagaagtc--atgtgttctcgacatcgttactgtggaagtcgagaacttagagtgagtgggataatgg |
9617439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University