View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3280_low_9 (Length: 217)
Name: NF3280_low_9
Description: NF3280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3280_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 12 - 201
Target Start/End: Complemental strand, 40167252 - 40167054
Alignment:
| Q |
12 |
tcatcataaaaaggtaaattttcgattactaagttacttgacaagaaaaattaacggaaaatgacctttc---------ttaaaactaatttctaagaaa |
102 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
40167252 |
tcatcataaaaaggtgaatttccgattactaagttacttgacaagaaaaattaacggaaaatgaccttacacgcggattttagaactaatttctaagaaa |
40167153 |
T |
 |
| Q |
103 |
gggacctaagagtggaggaggtatggatttacttatcttgttcaaatttaatgatatggtaccatttgatctttaaactacaccaaaaaaccaagatgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40167152 |
gggacctaagagtggaggaggtatggatttacttatcttgttcaaatttaatgatatggtaccatttgatctttaaactacaccaaaaaaccaagatgc |
40167054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University