View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282-Insertion-26 (Length: 247)
Name: NF3282-Insertion-26
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282-Insertion-26 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 28717238 - 28717096
Alignment:
| Q |
6 |
cacataaatgccaaaatattttaaaaaacactggattaagaccagctggacctggtgctttatcagaatgcatagaaacaagagcatttttatactcact |
105 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28717238 |
cacataaatgccaaaatcttttaaaaaacaccggattaagaccagctggacctggtgctttatcagaatgcatagaaacaagagcatttttaaactcact |
28717139 |
T |
|
| Q |
106 |
tacttgaaacggagcaagtagtttcacgttgtcctcattggta |
148 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
28717138 |
tacttgaaacggagcaagtaatttcaggttgtcctcattggta |
28717096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 148 - 247
Target Start/End: Original strand, 25661631 - 25661730
Alignment:
| Q |
148 |
aaatctttaacggggtaaaccgcgaggttgatgaaatggtggaggatattaaagtgctatcttggcggtggatgttacaaaggatgaagatcccggtgtg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25661631 |
aaatctttaacggggtaaaccgcgaggttgatgaaatggtggatgatattaaagttctatcttggcggtggatgttacaaaggatgaagatcccggtgtg |
25661730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 218
Target Start/End: Complemental strand, 53112025 - 53111993
Alignment:
| Q |
186 |
gtggaggatattaaagtgctatcttggcggtgg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
53112025 |
gtggaggatattaaagtgctatcgtggcggtgg |
53111993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University