View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282-Insertion-28 (Length: 254)
Name: NF3282-Insertion-28
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282-Insertion-28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 158 - 253
Target Start/End: Complemental strand, 4638518 - 4638423
Alignment:
| Q |
158 |
ctaaggttgtaattcatcttcttcctctggttcgtttgccattaattttcaaggtcagggttcttttttattgctttgcatggcccttttttgttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4638518 |
ctaaggttgtaattcatcttcttcctcaggttcgtttgccattaattttcaaggtcagggttcttttttattgctttgcatggcccttttttgttc |
4638423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 4638676 - 4638590
Alignment:
| Q |
8 |
cattccctcccactacctcattcatgtctttcatcacttgagtccggtacccttttctttctccacaacaggttctggtccggttcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4638676 |
cattccctcccactacctcattcatgtctttcatcacttgagtccggttcccttttctttctccacaacaggttctggtctggttcc |
4638590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University