View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282-Insertion-36 (Length: 117)
Name: NF3282-Insertion-36
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282-Insertion-36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 50072373 - 50072482
Alignment:
| Q |
8 |
gtattaaaaactaaagaaagatatgtctcnnnnnnnaacttcatgcatgtaaattgcaaaccctactgctactgcagaagtacaattatgaatcaacatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50072373 |
gtattaaaaactaaagaaagatatgtctctttttttaacttcatgcatgtaaattgcaaaccctactgctactgcagaagtacaattatgaatcaacatc |
50072472 |
T |
|
| Q |
108 |
aaaattttag |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
50072473 |
aaaattttag |
50072482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University