View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282-Insertion-37 (Length: 96)
Name: NF3282-Insertion-37
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282-Insertion-37 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 3e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 35684147 - 35684058
Alignment:
| Q |
7 |
agtttactttcacatgtatacatcatattagctaagtggcaacatcactcatcgtgtcttcaagccaaacacccttattgatcctaaaag |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35684147 |
agtttactttcacatgtatacatcatattagctaaatggcaacatcactcattgtgtcttcaagccaaacacccttattgatcctaaaag |
35684058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University