View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_high_24 (Length: 234)
Name: NF3282_high_24
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 41366538 - 41366323
Alignment:
| Q |
18 |
atgcctcatccaatttctatatgggttgggaacnnnnnnnctcaattgttttccagcttgcttttttacgactcaactcatgaaaacttatgagctaatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41366538 |
atgcctcatccaatttctatatgggttgggaacaaaaaaactcaattgtttttcagcttgcttttttacgactcaactcatgaaaacttatgagctaatg |
41366439 |
T |
 |
| Q |
118 |
agttggtcggcaagcctgcccc---annnnnnnnnaacagctatagcttgagcagtttagctcttatgggatgtgattagagttccctattaattttttg |
214 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41366438 |
agttggccggcaagcctgccccctttttttttttttacaactatagcttgagcagtttagctcttatgggatatgattagagttccctattaattttttg |
41366339 |
T |
 |
| Q |
215 |
agtcgtgtccaacttc |
230 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
41366338 |
agtcatgtccaacttc |
41366323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University