View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3282_low_10 (Length: 338)

Name: NF3282_low_10
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3282_low_10
NF3282_low_10
[»] chr3 (2 HSPs)
chr3 (263-322)||(25730662-25730721)
chr3 (142-190)||(25730794-25730842)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 263 - 322
Target Start/End: Complemental strand, 25730721 - 25730662
Alignment:
263 cactcgatcaaacgtttcttgcgtcacaaactaagattggtggatacataactatcatct 322  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
25730721 cactcgatcaaacgtttcttgcgtcacaaactaagatttgtggatacataactatcatct 25730662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 142 - 190
Target Start/End: Complemental strand, 25730842 - 25730794
Alignment:
142 ctattctcacaagataaaattgttgaacgaatggtgtaggtaagtcacc 190  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||    
25730842 ctatactcacaagataaaattgttgaacgaatggtgtaggtaagtcacc 25730794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University