View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_10 (Length: 338)
Name: NF3282_low_10
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 263 - 322
Target Start/End: Complemental strand, 25730721 - 25730662
Alignment:
| Q |
263 |
cactcgatcaaacgtttcttgcgtcacaaactaagattggtggatacataactatcatct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25730721 |
cactcgatcaaacgtttcttgcgtcacaaactaagatttgtggatacataactatcatct |
25730662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 142 - 190
Target Start/End: Complemental strand, 25730842 - 25730794
Alignment:
| Q |
142 |
ctattctcacaagataaaattgttgaacgaatggtgtaggtaagtcacc |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25730842 |
ctatactcacaagataaaattgttgaacgaatggtgtaggtaagtcacc |
25730794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University