View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_12 (Length: 300)
Name: NF3282_low_12
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 280
Target Start/End: Complemental strand, 31195260 - 31194996
Alignment:
| Q |
16 |
attcaaccccaaattcgatggatactagctaacacttcatttaccaacaaaatgtgtcttttgttaatcggtttagcccataaaatcactaatgaacgat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31195260 |
attcaaccccaaattcgatggatactagctaacacttcatttaccaacagaatgtgtcttttgttaatcggtttagcccataaaatcactaatgaacgat |
31195161 |
T |
|
| Q |
116 |
atacatttaatgattttttgtaattttaatacacaaactatagtgacaacgtcacacacttttagcgatgaaaatgataatttaatctactttttacgta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31195160 |
atacatttaatgattttttgtaattttaatacacaaactatagtgacaacgtcacacacttttagcgatgaaaatgataatttaatctactttttacgta |
31195061 |
T |
|
| Q |
216 |
ttgattacaattgttaaaactactatgatctactttttatatcattacttgaaagtgacacaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31195060 |
ttgattacaattgttaaaactactatgatctactttttatatcattacttgaaagtgacacaccc |
31194996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University