View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_16 (Length: 279)
Name: NF3282_low_16
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 29464684 - 29464422
Alignment:
| Q |
17 |
aaaccatagcctggagnnnnnnncttcccattgagaaaaacatttcctgtcattaccacattttttgcaagtctacctgcaacagcatttggacatttag |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464684 |
aaaccatagcctggagtttttttcttcccattgagaaaaacatttcctgtcattaccacattttttgcaagtctacctgcaacagcatttggacatttag |
29464585 |
T |
 |
| Q |
117 |
attaagcctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgat |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464584 |
attagccctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgat |
29464485 |
T |
 |
| Q |
217 |
gatgctaatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464484 |
gatgctaatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacac |
29464422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 99
Target Start/End: Complemental strand, 29432572 - 29432513
Alignment:
| Q |
40 |
cttcccattgagaaaaacatttcctgtcattaccacattttttgcaagtctacctgcaac |
99 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29432572 |
cttcccattgagaagaacatttcccgtcatcaccacattttttggaagtctacctgcaac |
29432513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University