View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_22 (Length: 250)
Name: NF3282_low_22
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 49806978 - 49807220
Alignment:
| Q |
9 |
agcacagagattagaaacctaagccgaacgttaaaagcgccatcgtgtatataaacacgcacacgaaaacaaaagaaacactttacgttttcccggcgag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49806978 |
agcacagagattagaaacctaagccgaacgttaatagcgccatcgtgtatataaacacgcacacgaaaacaaaagaaacactttacgttttcccggcgag |
49807077 |
T |
 |
| Q |
109 |
ttttcaagccaccgaagtttttgtctttcttctgaatttttctgagaaatttcttcaactccgagaaatctcaatagg-tttttctctaaactcgcagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49807078 |
ttttcaagccaccgaagtttttgtctttcttctgaattttgctgagaaatttcttcaactccgagaaatctcaataggttttttctctaaactcgcagtt |
49807177 |
T |
 |
| Q |
208 |
tctctgtttttcgctgctgctgttgtttcgatcaatggtgttt |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49807178 |
actctgtttttcgctgttgctgttgtttcgatcaatggtgttt |
49807220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University