View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3282_low_25 (Length: 234)

Name: NF3282_low_25
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3282_low_25
NF3282_low_25
[»] chr2 (1 HSPs)
chr2 (18-230)||(41366323-41366538)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 41366538 - 41366323
Alignment:
18 atgcctcatccaatttctatatgggttgggaacnnnnnnnctcaattgttttccagcttgcttttttacgactcaactcatgaaaacttatgagctaatg 117  Q
    |||||||||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41366538 atgcctcatccaatttctatatgggttgggaacaaaaaaactcaattgtttttcagcttgcttttttacgactcaactcatgaaaacttatgagctaatg 41366439  T
118 agttggtcggcaagcctgcccc---annnnnnnnnaacagctatagcttgagcagtttagctcttatgggatgtgattagagttccctattaattttttg 214  Q
    |||||| |||||||||||||||              ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
41366438 agttggccggcaagcctgccccctttttttttttttacaactatagcttgagcagtttagctcttatgggatatgattagagttccctattaattttttg 41366339  T
215 agtcgtgtccaacttc 230  Q
    |||| |||||||||||    
41366338 agtcatgtccaacttc 41366323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University