View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_26 (Length: 227)
Name: NF3282_low_26
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 29464215 - 29464441
Alignment:
| Q |
1 |
catgttacccaaactacggtttataagttatagccatgcattggtgtttttccttttcaccaattatcaaattccatgaatattgattgccaaaacacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464215 |
catgttacccaaactacggtttataagttatagccatgcattggtgtttttccttttcaccaattatcaaattccatgaatattgattgccaaaacacac |
29464314 |
T |
 |
| Q |
101 |
tttaaagccccatggcccatgctggggaccatggtttttgtcttctcatttgcactataatggaatttgaccttttcacctaatcatcacatatcataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464315 |
tttaaagccccatggcccatgctggggaccatggtttttgtcttctcatttgcactataatggaatttgaccttttcacctaatcatcacatatcataaa |
29464414 |
T |
 |
| Q |
201 |
tggttgagtgttgcataatctatcatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29464415 |
tggttgagtgttgcataatctatcatg |
29464441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University