View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3282_low_28 (Length: 211)
Name: NF3282_low_28
Description: NF3282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3282_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 13212980 - 13213154
Alignment:
| Q |
18 |
cttcgttgtttcgttctcttttttggcctcggcttaagctcccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212980 |
cttcgttgtttcgttctcttttttggcctcggcttaagctcccattgccactttgttgttcctcttcattggtttggtggttggtgtgaaattgatggtg |
13213079 |
T |
|
| Q |
118 |
aggatgaagatgaaggtctctagtgagaaatggaggtggaagaggacgaccttgtgctacttgatccatgatttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213080 |
aggatgaagatgaaggtctctagtgagaaatggaggtggaagaggacgaccttgtgctacttgatccatgatttg |
13213154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University