View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_high_18 (Length: 294)
Name: NF3283_high_18
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 133 - 276
Target Start/End: Complemental strand, 52824640 - 52824495
Alignment:
| Q |
133 |
gatatgatagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat |
232 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824640 |
gatatgacagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat |
52824541 |
T |
|
| Q |
233 |
atata--tataataagatgtgacaatgttaattgggagggattgtt |
276 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824540 |
atatatatataataagatgtgacaatgttaattgggagggattgtt |
52824495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 9 - 86
Target Start/End: Complemental strand, 52824774 - 52824696
Alignment:
| Q |
9 |
gaggagcacagaaacaaacaaaatattcatactagagctacatcaacgttttgtgtaca-ccctgtagtgtatacatct |
86 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52824774 |
gaggagcacaaaaacaaacaaaatattcatactagagctacatcaacgttttgtgtacacccctgtagtgtatacatct |
52824696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University