View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3283_high_18 (Length: 294)

Name: NF3283_high_18
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3283_high_18
NF3283_high_18
[»] chr3 (2 HSPs)
chr3 (133-276)||(52824495-52824640)
chr3 (9-86)||(52824696-52824774)


Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 133 - 276
Target Start/End: Complemental strand, 52824640 - 52824495
Alignment:
133 gatatgatagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat 232  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52824640 gatatgacagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat 52824541  T
233 atata--tataataagatgtgacaatgttaattgggagggattgtt 276  Q
    |||||  |||||||||||||||||||||||||||||||||||||||    
52824540 atatatatataataagatgtgacaatgttaattgggagggattgtt 52824495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 9 - 86
Target Start/End: Complemental strand, 52824774 - 52824696
Alignment:
9 gaggagcacagaaacaaacaaaatattcatactagagctacatcaacgttttgtgtaca-ccctgtagtgtatacatct 86  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
52824774 gaggagcacaaaaacaaacaaaatattcatactagagctacatcaacgttttgtgtacacccctgtagtgtatacatct 52824696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University