View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_high_24 (Length: 253)
Name: NF3283_high_24
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 43445133 - 43445365
Alignment:
| Q |
1 |
cactacatactaaaggtttatcaaatgtttgtcatgtgtcccgatgccaattcatgtgggataatccatacaaagctttgctctaactttaaaagggaca |
100 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
43445133 |
cactacatattaaaggtgtatcaaatgtttgacatgtgtcccgatgccaattcatgtgggataatccatacaaa------ctctaactttaaatgggaca |
43445226 |
T |
 |
| Q |
101 |
ttgggattggtcccccagattagttagtccttggaccgtaaatcaagnnnnnnngttattgtttgacatgtgtcattgtccgatatgacactaacacatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43445227 |
ttgggattggtcccccagattagttagtccttggaccgtaaatcaagaaaaa--gttattgtttgacatgtgtcattgtccgatatgacactaacacatg |
43445324 |
T |
 |
| Q |
201 |
tgattatattcaatcacatctacatgtcgattttgtttctg |
241 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
43445325 |
tgattatattcaatcacatctaggtgtcaattttgtgtctg |
43445365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University