View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_high_28 (Length: 250)
Name: NF3283_high_28
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 18540373 - 18540490
Alignment:
| Q |
1 |
tgaattctcttagttccttgcagtttctatgtaaggttcttttcatatacttttgaagttgaatataaatacaatgatgtgatagtgatatttgttttta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || ||||||| || |||| |||||||||||||||||||||||||||| |||||| ||||| ||| |
|
|
| T |
18540373 |
tgaattctcttaattccttgcagtttctatgtaagcttattttcatgtaattttaaagttgaatataaatacaatgatgtgatggtgatacttgttctta |
18540472 |
T |
|
| Q |
101 |
ataaaagtttatggatat |
118 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
18540473 |
attaaagtttatggatat |
18540490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 171 - 243
Target Start/End: Original strand, 18540988 - 18541060
Alignment:
| Q |
171 |
tttagaatcatgctttcttatgttggttatgattttgaacttgaatgttcttgaatattattttcctttgctt |
243 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
18540988 |
tttagaaccatggtttcttatgttggttatgattttgaacttgaacattcttgaatattattttcttttgctt |
18541060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University