View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_low_29 (Length: 252)
Name: NF3283_low_29
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 199
Target Start/End: Complemental strand, 18540227 - 18540034
Alignment:
| Q |
6 |
agagaaaagaaaccatgtttgtaagcaagctatattggctttatgatgtgttggcaaatagaaaggtcaggtgtcacattgtctgatcttctacccctga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
18540227 |
agagaaaagaaaccatgtttgtaagcaagctatattggctttatgatgtgttggcaaatagaaaggtcaggtgtctcattctctgatcttctacccctga |
18540128 |
T |
 |
| Q |
106 |
aagtcaggtgtgctggctacttaacaacagccacgtggactcaactcatactcatcataatcataatacttctaatttcttgaaccgcttatat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18540127 |
aagtcaggtgtgctggctacttaacaacagccacgtggactcaactcatactcatcataatcataatacttctaatttcttgaaccgcttatat |
18540034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 164
Target Start/End: Complemental strand, 43148733 - 43148668
Alignment:
| Q |
98 |
acccctgaaagtcaggtgtgctggctacttaacaacagccacgtggactcaactcatactcatcata |
164 |
Q |
| |
|
|||| ||||||| |||||| || ||||||| ||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
43148733 |
acccatgaaagttaggtgt-cttgctacttgacaactgccacgtggacttaactcatagtcatcata |
43148668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University