View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_low_32 (Length: 250)
Name: NF3283_low_32
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 52824741 - 52824937
Alignment:
| Q |
1 |
tagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttcttcataaatcagtgtaaaatattaaatatttctttcacattttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52824741 |
tagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttcttcataaatcagtgtaaaatattaaatatgtctttcacattttgt |
52824840 |
T |
 |
| Q |
101 |
aaataagatctttaattgaattaaataactcaacttgattgattaatttttgtttgcaacttgttaaaaggggtagtacgtcttgttaaatgggatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
52824841 |
aaataagatctttaattgaattaaataactcaacttgattgattaatttttgtttgcaacttgttaaaaggggtagtacatcttgttaaatgagatt |
52824937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 197 - 245
Target Start/End: Original strand, 52824960 - 52825008
Alignment:
| Q |
197 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatctcac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52824960 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatatcac |
52825008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University