View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3283_low_42 (Length: 213)
Name: NF3283_low_42
Description: NF3283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3283_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 8349331 - 8349135
Alignment:
| Q |
5 |
aaacaagagcgtgtcacaaccattgatgcacattgtaccgaatcagcaacttaccgtccatgatttgctgccgaatggatnnnnnnntggaatttagatg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
8349331 |
aaacaagagcgtgtcacaaccattgatgcacattgtaccgaatcagcaatttaccgtccatgatttgctgccgaatggataaaaaagtggaaattagatg |
8349232 |
T |
 |
| Q |
105 |
tgcttcagcagttcagctgtaccccttttcctctttgtggggccggacgagcgtatttggaggctggaaagacatggaaacagtcagctcacaggtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349231 |
tgcttcagcagttcagctgtaccccttttcctctttgtggggccggacgagcgtatttggaggctggaaagacatggaaacagtcagctcacaggtt |
8349135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 11993944 - 11994025
Alignment:
| Q |
1 |
tagcaaacaagagcgtgtcacaaccattgatgcacattgtaccgaatcagcaacttaccgtccatgatttgctgccgaatgg |
82 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
11993944 |
tagcaaacaagagcatggaacaaccattgatgcacattgtactgaatcagcaacttaaagtccgagatttgctgcagaatgg |
11994025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University