View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3284_high_9 (Length: 218)
Name: NF3284_high_9
Description: NF3284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3284_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 23939008 - 23939187
Alignment:
| Q |
17 |
atcaaagtttgaccatcctgttaagctgataaaataatcgctcttctacataatcccaaagttcattgttcctttaagatatctcaagcgtctcttagtt |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23939008 |
atcaaagtttgaccatcatgttaagctgataaaataatcgcttttctacataatcccaaagttcattgttcctttaagatatctcaagattctcttagtt |
23939107 |
T |
 |
| Q |
117 |
gctgccgattgcatttttgtaggtctttccatatatctagccacaagacatacataataggttagatcaggtctagtagc |
196 |
Q |
| |
|
| |||| | || |||||||||||||||||||||||||||||| |||||||||||||||| || |||||| |||||||||| |
|
|
| T |
23939108 |
gatgccaagtgaatttttgtaggtctttccatatatctagcctcaagacatacataataagtgagatcaagtctagtagc |
23939187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University