View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3284_low_8 (Length: 229)
Name: NF3284_low_8
Description: NF3284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3284_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 26826096 - 26825888
Alignment:
| Q |
1 |
aaactggtggagatagatatactccatcgattatctaccctatattgcctatccaaagagtagtaaaactattactgtatttgaacatcaagatagtttt |
100 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26826096 |
aaactggtggagagagatata-----tctattatctaccctatattgcctatccaaagagtagtaaaactattactgtatttgaacatcaagatagtttt |
26826002 |
T |
 |
| Q |
101 |
acttgnnnnnnntaattatgtcgttgtaagataactttaaaaagacggtagaaataagcatatctggtacaagtttaaaactatatacacttgtttgtta |
200 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26826001 |
acttgaaaaaaataattatatcgttgtaagataacttttaaaagacggtagaaataagcatatctggtacaagtttaaaactatatacacttgtttgtta |
26825902 |
T |
 |
| Q |
201 |
gctatgttgagttt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26825901 |
gctatgttgagttt |
26825888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University