View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3285_high_6 (Length: 315)
Name: NF3285_high_6
Description: NF3285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3285_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 2017826 - 2018078
Alignment:
| Q |
1 |
agttttgtgacaaagtgttgtcattcaatgttgtctaaggcgga-------atatagccgatggttaaaaatcatctatacaaacacgccattgcagtct |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
2017826 |
agttttgtgacaaagtgttgtcaatcaatgttgtctatggcggatggcagaatatagccgatggttaaaaatcctctatacaaacacgccattgcagcct |
2017925 |
T |
|
| Q |
94 |
atggcactgcgatgatgggcattccttcacaaatgcccgccatggtggtgccaagaccaccatttagtaacactgttgtcaaaaagcgggttatagtggc |
193 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2017926 |
atgacactgcgatgatgggcattccttcccaaatgcccgccatggtggtgccacgaccaccatttagtaacactgttgtcaaaaagc-ggttatagtggc |
2018024 |
T |
|
| Q |
194 |
gctatggcagtgcagcgtaaagggatttatgattgataacattgattttagatg |
247 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2018025 |
gctatgacagtgcagcgtaaagggatttgtgattgataacattgattttagatg |
2018078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 2020460 - 2020527
Alignment:
| Q |
130 |
ccgccatggtggtgccaagaccaccatttagtaacactgttgtcaaaaagcgggttatagtggcgctat |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
2020460 |
ccgccatggtggtgccatgaccaccatttagtaacactgctgtcaaaaagc-ggttatagtggcactat |
2020527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 2020346 - 2020434
Alignment:
| Q |
39 |
ggcggaatatagccgatggttaaaaatcatctatacaaacacgccattgcagtctatggcactgcgatgatgggcattccttcacaaat |
127 |
Q |
| |
|
|||||| |||||| |||||||||||||| ||||| ||||| |||||||||| ||||||||| | || || ||||||||||||||||| |
|
|
| T |
2020346 |
ggcggagtatagctgatggttaaaaatccgctatataaacaagccattgcagcctatggcaccgtgacgacaggcattccttcacaaat |
2020434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University