View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3285_high_9 (Length: 285)
Name: NF3285_high_9
Description: NF3285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3285_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 97 - 272
Target Start/End: Original strand, 41834501 - 41834674
Alignment:
| Q |
97 |
tagcatgattcgacaatgctccaagcctatttttgtnnnnnnnctgaataatgttcaaagagttcgatcaccgatatgtattttgaatttcaattgctct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
41834501 |
tagcatgattcgacaatgctccaagcctatttttgtaaaaaaactgaataatgtttaaagagttcgaccaccgatatgtattttgaatttcaattactc- |
41834599 |
T |
|
| Q |
197 |
gaataatatggatataatgtattaccnnnnnnnnntatgggcatacataatgtcatgcaatttatatgtatatctc |
272 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41834600 |
-aataatatggatataatgtattaccaaaaaaaaatatgggcatacataatgtcatgcaatttatatgtatatctc |
41834674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 47 - 88
Target Start/End: Original strand, 41834414 - 41834455
Alignment:
| Q |
47 |
gagagctaagctctcaaataaaaggtttcggcaacatcactt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41834414 |
gagagctaagctctcaaataaaaggtttcggcaacatcactt |
41834455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University