View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3285_low_10 (Length: 271)
Name: NF3285_low_10
Description: NF3285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3285_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 37497533 - 37497288
Alignment:
| Q |
18 |
actaatattatcacccaaaaagtggggaacacaacttgagaatctatgtaccacatcatcttctatattctgaaaaacaatgagtgttgctgtgctcgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497533 |
actaatattatcacccaaaaagtggggaacaccacttgagaatctatgtaccacatcatcttctatattctgaaaaacaatgagtgttgctgtgctcgta |
37497434 |
T |
|
| Q |
118 |
tctgagcttttctgaatttacaaagcagatagtaacttgataatcaatacgtgcggttctcaagctgaaagacattatgggttttatgcaaaatgaccta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497433 |
tctgagcttttctgaatttacaaagcagatagtaacttgataatcaatacgtgcggttctcaagctgaaagacattatgggttttatgcaaaatgaccta |
37497334 |
T |
|
| Q |
218 |
ataatgggaaaaagtcaccaattatttgcaaaatgcgctctctgct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37497333 |
ataatgggaaaaagtcaccaattatttgcaaaatgcgctccctgct |
37497288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University