View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3285_low_7 (Length: 314)
Name: NF3285_low_7
Description: NF3285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3285_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 40647963 - 40648143
Alignment:
| Q |
1 |
taccttttccttgtccgcttttcaatttcagttgacaagtgctatgatgnnnnnnngttaaaaacgcaaacagaatcacaaatcgtatcttccaaacaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40647963 |
taccttttccttgtccgcttttcaatttcagttgacaagtgctatgatgaaaaaa-gttaaaaactcaaacagaatcacaaatcgtatcttccaaacaca |
40648061 |
T |
 |
| Q |
101 |
aaacaatcaatatctttcaacaacgtaac-----tattgtattgtactacagaaacacacgaactacggagtacagacataa |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40648062 |
aaacaatcaatatctttcaacaacgtaactattgtattgtattgtactacacaaacacacgaactacggagtacagacataa |
40648143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 212 - 304
Target Start/End: Original strand, 40648166 - 40648258
Alignment:
| Q |
212 |
tgcatcgatcgatctagatccccatccagtatgttaattatatttacccagtgtagatgtgaacaccaacagcaatgagtaaaatagtgatga |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648166 |
tgcatcgatcgatctagatccccatccagtatgttaattatatttacccagtgtagatgtgaacaccaacagcaatgagtaaaatagtgatga |
40648258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University