View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3286_high_1 (Length: 363)
Name: NF3286_high_1
Description: NF3286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3286_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 47893656 - 47893422
Alignment:
| Q |
1 |
tgttccactcagggattttaaggtttggaattttgatcatggtttcggatggattaaggaatggtgtatgagtgagtgagaggagtaattgattgcagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47893656 |
tgttccactcagggattttaaggtttggaattttgatcatggtttcggatggattaaggaatggtgtatgagtgactgagaggagtaattgattgcagtg |
47893557 |
T |
|
| Q |
101 |
tgactcgtgtagctagctagctatatatagaaagaaatgaatatca--atg---ctatgcatgtggtttgaaaaatttaactgtggtttgagtaagtcta |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | ||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893556 |
tgactcgtgtagcta----gctatatatagaaagaaatgaataatatcatgtgcctatgtatgtggtttgaaaaatttaactgtggtttgagtaagtcta |
47893461 |
T |
|
| Q |
196 |
cttggcttgctttataatggtaattattggcttctacct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893460 |
cttggcttgctttataatggtaattattggcttctacct |
47893422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 233 - 353
Target Start/End: Complemental strand, 47893378 - 47893258
Alignment:
| Q |
233 |
ctaaaaatgcaaatgccaaacttatcaatatatatgcaaatcttgtaaacttctcctaaatatccaatttgtcgactttgttttgatggaattgataaac |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893378 |
ctaaaaatgcaaatgccaaacttatcaatatatatgcaaatcttgtaaacttctcctaaatatccaatttgtcgactttgttttgatggaattgataaac |
47893279 |
T |
|
| Q |
333 |
caccctccattttgtcttcat |
353 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47893278 |
caccctccattttgtcttcat |
47893258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University