View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3286_high_13 (Length: 211)
Name: NF3286_high_13
Description: NF3286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3286_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 50235669 - 50235481
Alignment:
| Q |
9 |
gacagagatgaacctacattgcaggctagcaccgttttgaatagtgaattctttactcaaaacacataaagttatgcaccataaaacgtatgtaaagaat |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235669 |
gacagagtagaacctacattgcaggctagcaccgttttgaatagtgaattctttactcaaaacacataaagttatgcaccataaaacgtatgtaaagaat |
50235570 |
T |
 |
| Q |
109 |
ccacatcaatcatt-nnnnnnngtgagagatatattcaatctgaacaaacgaatcccataagcacaaatcaaggtgttacattatatat |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235569 |
ccacatcaatcattaaaaaaaagtgagagatatattcaatctgaacaaacgaatcccataagcacaaatcaaggtgttacattatatat |
50235481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University