View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3286_high_9 (Length: 255)
Name: NF3286_high_9
Description: NF3286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3286_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 6803568 - 6803376
Alignment:
| Q |
1 |
acttatgttagacttgttcctttgattgtcttcttgtttgccacattatgtatgtatttcaactatacttctcatcaacacataccatatttat------ |
94 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
6803568 |
acttatgttaggcttgctcctttggttgtcttcttgtttgccacattatgtatgtatttcaactaaacttctcatcaacacataccatgtttatattttt |
6803469 |
T |
|
| Q |
95 |
-ttatttatagtttagaactcacgagaaatttaattccaaacttctcccaattactacttacatataaaatcattcaccaattttctcacaaa |
186 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803468 |
tttatttatagtttagaactcatgagaaatttaattccaaacttctcccaattactacttacatataaaatcattcaccaattttctcacaaa |
6803376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 248
Target Start/End: Complemental strand, 6803340 - 6803270
Alignment:
| Q |
178 |
tctcacaaacttatcactaattttattgtttaatggtatgtgcattgttccaaccctatttgcctttgctt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||| |||||||| |
|
|
| T |
6803340 |
tctcacaaacttatcactaattttattgtttaatggtatgtgcattgtttctaccctaattgtctttgctt |
6803270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 78
Target Start/End: Complemental strand, 6786255 - 6786179
Alignment:
| Q |
2 |
cttatgttagacttgttcctttgattgtcttcttgtttgccacattatgtatgtatttcaactatacttctcatcaa |
78 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||| |||||| ||| ||||||||||| | |||| |||||||||| |
|
|
| T |
6786255 |
cttatgttaggctcattcctttggttgtcttcttgcttgccatattctgtatgtattttagatatatttctcatcaa |
6786179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 7941072 - 7941136
Alignment:
| Q |
21 |
tttgattgtcttcttgtttgccacattatgtatgtatttcaactatacttctcatcaacacatac |
85 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||||||||| ||| || |||||| ||| |||||| |
|
|
| T |
7941072 |
tttggttgtcttcttgcttgccacattttgtatgtattttaaccttatttctcaccaatacatac |
7941136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University