View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3286_low_14 (Length: 237)
Name: NF3286_low_14
Description: NF3286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3286_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 41876871 - 41876983
Alignment:
| Q |
1 |
atttgaaataaaatatatttgaattaattcaaaatttatacaacttgagtattttacataccatttatttgaatttataaataacattttattgtaattc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
41876871 |
atttaaaataaaatatatttgaattaattcgaaatttatacaacttgagtattttacataccatttatttgaatttacaaataatattttattgtaattt |
41876970 |
T |
 |
| Q |
101 |
aaacggtaccaaa |
113 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
41876971 |
aaacggcaccaaa |
41876983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 41876991 - 41877036
Alignment:
| Q |
166 |
ggtttgatccctgcatctcaatttattttaagaaatttgtgttttt |
211 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
41876991 |
ggttttatccctacatctcaatttattttaagaaatttgagttttt |
41877036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University