View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3286_low_9 (Length: 264)
Name: NF3286_low_9
Description: NF3286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3286_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 47893191 - 47892941
Alignment:
| Q |
1 |
tcaaacagataattatctcatgtaattatttgttattttaaaatactnnnnnnntttaatcacannnnnnnnactaataccttgatatgatactatctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47893191 |
tcaaacagataattatctcatgtaattatttgttattttaaaatactaaaaaaatttaatcacattttttttactaataccttgatatgatactatctta |
47893092 |
T |
 |
| Q |
101 |
atccatttaataattttattnnnnnnntgtagattagataatctaaattatactaaaatataagacggaaatagtacttttctagcaattaatgctaatt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893091 |
atccatttaataattttattaaaaaaatgtagattagataatctaaattatactaaaatataagacggaaatagtacttttctagcaattaatgctaatt |
47892992 |
T |
 |
| Q |
201 |
tgtcgtctacggttcatctattatatagccatgcccccctcttagccatct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47892991 |
tgtcgtctacggttcatctattatatagccatgcccccctcttagccatct |
47892941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University