View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3287_high_2 (Length: 377)

Name: NF3287_high_2
Description: NF3287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3287_high_2
NF3287_high_2
[»] chr1 (1 HSPs)
chr1 (213-355)||(35303065-35303205)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 213 - 355
Target Start/End: Complemental strand, 35303205 - 35303065
Alignment:
213 gtggtcgaggttcgatcctcaaacctttgcatatattttatgcatcggccaactaagctaagctattcactctaattatacaacagaagcattttaaaat 312  Q
    |||| |||| ||||||||||||| ||||||||||  ||||||||| || ||||| |||||| ||||||||||||||||||||||||||||||||||||||    
35303205 gtggccgagtttcgatcctcaaatctttgcatat--tttatgcattggacaactgagctaaactattcactctaattatacaacagaagcattttaaaat 35303108  T
313 actggaactgaaaaacaaagcattgcattaaccaaccatgaat 355  Q
    ||| |||||||||||||||||||||||||||||||||||||||    
35303107 acttgaactgaaaaacaaagcattgcattaaccaaccatgaat 35303065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University