View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288-Insertion-23 (Length: 184)
Name: NF3288-Insertion-23
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288-Insertion-23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 10 - 184
Target Start/End: Complemental strand, 8803882 - 8803715
Alignment:
| Q |
10 |
tttggctccacatattatatgctttcatttgcgtaaattaatagtaatttttaatcatgctgagcattcgtccttcaaacaatttcatgcttaactttcg |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8803882 |
tttggctccactaattatatgctttcatttgcgtaaattaatagtaatttttaatcatgctgaacattcgtccttcaaaaaatttcatgcttaactttcg |
8803783 |
T |
|
| Q |
110 |
ttaactttccaccctacacctacggagctagaaaatatttcgtgatggaagatggacacacatactcgtacacta |
184 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8803782 |
ttaa-tttccac------cctacggagctagaaaatatttcgtgatggaagatggagacacatactcgtacacta |
8803715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University