View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288-Insertion-24 (Length: 142)
Name: NF3288-Insertion-24
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288-Insertion-24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 10684518 - 10684385
Alignment:
| Q |
8 |
tttctttctctttcactttcactccactcacccttttctgcacaagtgcttaacaacatgaactctttttatacgctgaattgtggtgattaagaagnnn |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10684518 |
tttctttctctttcactttcactccactcacccttttctgcacaagtgcttaacaacatgtactctttttatacgctgaattgtggtgattaagaacaaa |
10684419 |
T |
|
| Q |
108 |
nnnngtgattctgtaaagtgggttcttgttcttc |
141 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
10684418 |
aaaagtgattctgtaaaatgggttcttgttcttc |
10684385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University