View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288R-Insertion-15 (Length: 256)
Name: NF3288R-Insertion-15
Description: NF3288R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288R-Insertion-15 |
 |  |
|
| [»] chr1 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 131 - 256
Target Start/End: Original strand, 14665378 - 14665503
Alignment:
| Q |
131 |
aattggggttaacttgctgcttcgaacttctgcccagtgttgcagcagtcctttgacgccttactgtttgagagcacatgcagacacagtagcagatgtc |
230 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14665378 |
aattggggttaacttgctgctgcgaacttctgcccagtgttgcagcagtcctttgacgccttactgtttgagagcacatgcagacacagtagcagatgtc |
14665477 |
T |
 |
| Q |
231 |
tctacattataccaaatcttgttgtt |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14665478 |
tctacattataccaaatcttgttgtt |
14665503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 119
Target Start/End: Original strand, 14653014 - 14653093
Alignment:
| Q |
40 |
atatgtcaataccaacctggttgtgaagcttcgaagaggctgcatccatattgcatttgtagcgtcctagatgaggtttt |
119 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| | | ||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
14653014 |
atatgtcagtaccaaccttgttgtgaagctccaataaggctgcatacacattgcatttgtagcgtcctagatgaggtttt |
14653093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 119
Target Start/End: Original strand, 14662805 - 14662884
Alignment:
| Q |
40 |
atatgtcaataccaacctggttgtgaagcttcgaagaggctgcatccatattgcatttgtagcgtcctagatgaggtttt |
119 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| | | ||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
14662805 |
atatgtcagtaccaaccttgttgtgaagctccaataaggctgcatacacattgcatttgtagcgtcctagatgaggtttt |
14662884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 14665337 - 14665378
Alignment:
| Q |
9 |
gaatccacattctcaagctgcaaaatcttttatatgtcaata |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14665337 |
gaatccacattctcaagctgcaaaatcttttatatgtcaata |
14665378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 59 - 104
Target Start/End: Complemental strand, 14687985 - 14687940
Alignment:
| Q |
59 |
gttgtgaagcttcgaagaggctgcatccatattgcatttgtagcgt |
104 |
Q |
| |
|
||||||||||| |||| ||||||||| || |||||||||||||||| |
|
|
| T |
14687985 |
gttgtgaagctccgaaaaggctgcattcacattgcatttgtagcgt |
14687940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University