View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288R-Insertion-16 (Length: 146)
Name: NF3288R-Insertion-16
Description: NF3288R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288R-Insertion-16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 10803380 - 10803512
Alignment:
| Q |
13 |
attagtccctcattttcggcagggtaattacgatgtaagattacctgaatggcctaggaggcttctctaaaacagcagaaaagaacacttcttgatcatc |
112 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10803380 |
attagtccctcattc-cggcagagagattacgatgtaagattacctgaatggcctaggaggcttctctaaaacagcagaaaagaaaacttcttgatcatc |
10803478 |
T |
|
| Q |
113 |
cttatcaatctttggaacaacaacccatttgtgc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10803479 |
cttatcaatctttggaacaacaacccatttgtgc |
10803512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University