View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288R-Insertion-17 (Length: 49)
Name: NF3288R-Insertion-17
Description: NF3288R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288R-Insertion-17 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 21965484 - 21965444
Alignment:
| Q |
9 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21965484 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
21965444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 21987920 - 21987880
Alignment:
| Q |
9 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21987920 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
21987880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 22139400 - 22139360
Alignment:
| Q |
9 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22139400 |
gattgtgtgtttaaaaatattgtagttaactatatttttct |
22139360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 18941105 - 18941141
Alignment:
| Q |
13 |
gtgtgtttaaaaatattgtagttaactatatttttct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18941105 |
gtgtgtttaaaaatattgtagttaactatttttttct |
18941141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University